Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation View Full Text


Ontology type: schema:ScholarlyArticle      Open Access: True


Article Info

DATE

2019-12

AUTHORS

Xiaojie Cui, Han Chen, Qiang Zhang, Ming Xu, Gu Yuan, Jiang Zhou

ABSTRACT

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation. More... »

PAGES

3966

Identifiers

URI

http://scigraph.springernature.com/pub.10.1038/s41598-019-39941-5

DOI

http://dx.doi.org/10.1038/s41598-019-39941-5

DIMENSIONS

https://app.dimensions.ai/details/publication/pub.1112641494

PUBMED

https://www.ncbi.nlm.nih.gov/pubmed/30850693


Indexing Status Check whether this publication has been indexed by Scopus and Web Of Science using the SN Indexing Status Tool
Incoming Citations Browse incoming citations for this publication using opencitations.net

JSON-LD is the canonical representation for SciGraph data.

TIP: You can open this SciGraph record using an external JSON-LD service: JSON-LD Playground Google SDTT

[
  {
    "@context": "https://springernature.github.io/scigraph/jsonld/sgcontext.json", 
    "about": [
      {
        "id": "http://purl.org/au-research/vocabulary/anzsrc-for/2008/0601", 
        "inDefinedTermSet": "http://purl.org/au-research/vocabulary/anzsrc-for/2008/", 
        "name": "Biochemistry and Cell Biology", 
        "type": "DefinedTerm"
      }, 
      {
        "id": "http://purl.org/au-research/vocabulary/anzsrc-for/2008/06", 
        "inDefinedTermSet": "http://purl.org/au-research/vocabulary/anzsrc-for/2008/", 
        "name": "Biological Sciences", 
        "type": "DefinedTerm"
      }
    ], 
    "author": [
      {
        "affiliation": {
          "alternateName": "Minzu University of China", 
          "id": "https://www.grid.ac/institutes/grid.411077.4", 
          "name": [
            "Beijing National Laboratory for Molecular Sciences, Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, 100871, Beijing, China", 
            "College of Life and Environmental Sciences, Minzu University of China, 100081, Beijing, China"
          ], 
          "type": "Organization"
        }, 
        "familyName": "Cui", 
        "givenName": "Xiaojie", 
        "type": "Person"
      }, 
      {
        "affiliation": {
          "alternateName": "Peking University", 
          "id": "https://www.grid.ac/institutes/grid.11135.37", 
          "name": [
            "Beijing National Laboratory for Molecular Sciences, Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, 100871, Beijing, China"
          ], 
          "type": "Organization"
        }, 
        "familyName": "Chen", 
        "givenName": "Han", 
        "type": "Person"
      }, 
      {
        "affiliation": {
          "alternateName": "Peking University", 
          "id": "https://www.grid.ac/institutes/grid.11135.37", 
          "name": [
            "Beijing National Laboratory for Molecular Sciences, Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, 100871, Beijing, China"
          ], 
          "type": "Organization"
        }, 
        "familyName": "Zhang", 
        "givenName": "Qiang", 
        "type": "Person"
      }, 
      {
        "affiliation": {
          "alternateName": "Peking University Third Hospital", 
          "id": "https://www.grid.ac/institutes/grid.411642.4", 
          "name": [
            "Department of Cardiology, Institute of Vascular Medicine, Department of Cardiology, Peking University Third Hospital, 100191, Beijing, China"
          ], 
          "type": "Organization"
        }, 
        "familyName": "Xu", 
        "givenName": "Ming", 
        "type": "Person"
      }, 
      {
        "affiliation": {
          "alternateName": "Peking University", 
          "id": "https://www.grid.ac/institutes/grid.11135.37", 
          "name": [
            "Beijing National Laboratory for Molecular Sciences, Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, 100871, Beijing, China"
          ], 
          "type": "Organization"
        }, 
        "familyName": "Yuan", 
        "givenName": "Gu", 
        "type": "Person"
      }, 
      {
        "affiliation": {
          "alternateName": "Peking University", 
          "id": "https://www.grid.ac/institutes/grid.11135.37", 
          "name": [
            "Beijing National Laboratory for Molecular Sciences, Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, 100871, Beijing, China"
          ], 
          "type": "Organization"
        }, 
        "familyName": "Zhou", 
        "givenName": "Jiang", 
        "type": "Person"
      }
    ], 
    "citation": [
      {
        "id": "https://doi.org/10.1039/c003428b", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1000437555"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1039/c003428b", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1000437555"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1111/j.1742-4658.2009.07464.x", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1001394805"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1007/bf01961241", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1002229729", 
          "https://doi.org/10.1007/bf01961241"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/20.15.4061", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1004745646"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja4125274", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1006544720"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gkp026", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1006892534"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1006/jmbi.2001.5047", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1007472005"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1007/s11426-014-5235-3", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1007868472", 
          "https://doi.org/10.1007/s11426-014-5235-3"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/nrd793", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1007921828", 
          "https://doi.org/10.1038/nrd793"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/nrd793", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1007921828", 
          "https://doi.org/10.1038/nrd793"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1002/jcc.20084", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1008225564"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gkm1069", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1009212183"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.4155/fmc.09.172", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1009323209"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gkl529", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1013971176"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/j.ymeth.2012.05.003", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1014529698"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/j.ymeth.2012.05.003", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1014529698"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja011977m", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1015941088"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja011977m", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1015941088"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gkm711", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1017092385"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1023/a:1020277223482", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1019179185", 
          "https://doi.org/10.1023/a:1020277223482"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1107/s0907444998003254", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1019779527"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/nrc749", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1021025403", 
          "https://doi.org/10.1038/nrc749"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/nrc749", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1021025403", 
          "https://doi.org/10.1038/nrc749"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1007/s00216-012-6322-y", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1021642836", 
          "https://doi.org/10.1007/s00216-012-6322-y"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/0022-2836(92)90497-8", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1022845043"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1172/jci116850", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1023361792"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/j.biochi.2008.02.026", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1024103020"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gkr233", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1026737043"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1158/1078-0432.ccr-11-1795", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1027513651"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1097/pap.0000000000000015", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1028998822"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1097/pap.0000000000000015", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1028998822"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/sj.onc.1204041", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1029565491", 
          "https://doi.org/10.1038/sj.onc.1204041"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/sj.onc.1204041", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1029565491", 
          "https://doi.org/10.1038/sj.onc.1204041"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/s0165-6147(00)01457-7", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1029818167"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/j.ymeth.2012.03.011", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1030526180"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/j.ymeth.2012.03.011", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1030526180"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/j.biochi.2008.02.019", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1032023729"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1039/c1ob05891f", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1033405620"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/nprot.2007.406", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1035232696", 
          "https://doi.org/10.1038/nprot.2007.406"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1002/mas.20315", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1035933673"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja065989p", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1035955792"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja065989p", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1035955792"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gkt784", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1039889426"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.3390/molecules171113073", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1040547844"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.3390/molecules171113073", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1040547844"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gki609", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1040818998"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja312403b", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1041077983"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja4118945", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1041180905"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja412128w", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1043381320"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gkl655", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1046370465"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1074/jbc.m303694200", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1049681429"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/ncb0901-785", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1049996477", 
          "https://doi.org/10.1038/ncb0901-785"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/ncb0901-785", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1049996477", 
          "https://doi.org/10.1038/ncb0901-785"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gkl610", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1050161161"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1371/journal.pgen.1003468", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1050265935"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1073/pnas.88.1.26", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1050446620"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1039/c0cs00134a", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1050613242"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1073/pnas.182256799", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1051343212"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/sj.onc.1210478", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1051505323", 
          "https://doi.org/10.1038/sj.onc.1210478"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/j.cbpa.2009.04.637", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1051506681"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1093/nar/gki553", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1052041968"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja310251r", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1052165928"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/35052073", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1053565592", 
          "https://doi.org/10.1038/35052073"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/35052073", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1053565592", 
          "https://doi.org/10.1038/35052073"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "sg:pub.10.1038/35052073", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1053565592", 
          "https://doi.org/10.1038/35052073"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ac900785m", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055071281"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ac900785m", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055071281"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/bi0355185", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055197862"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/bi0355185", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055197862"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/bi051618u", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055201030"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/bi051618u", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055201030"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/bi4015727", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055206371"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja205646q", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055850500"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja205646q", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055850500"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ja208483v", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1055851089"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/ol302918f", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1056253826"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1089/oli.2005.15.36", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1059303279"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1126/science.2470152", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1062539373"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1126/science.7892601", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1062650037"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.3998/ark.5550190.p008.384", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1071818299"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://app.dimensions.ai/details/publication/pub.1075287996", 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1021/jacs.6b12274", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1083734215"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1002/anie.201709184", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1092401801"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1002/anie.201709184", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1092401801"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/j.bmcl.2018.06.021", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1104562078"
        ], 
        "type": "CreativeWork"
      }, 
      {
        "id": "https://doi.org/10.1016/j.biochi.2018.06.024", 
        "sameAs": [
          "https://app.dimensions.ai/details/publication/pub.1105213939"
        ], 
        "type": "CreativeWork"
      }
    ], 
    "datePublished": "2019-12", 
    "datePublishedReg": "2019-12-01", 
    "description": "G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand c\u03b2 can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.", 
    "genre": "research_article", 
    "id": "sg:pub.10.1038/s41598-019-39941-5", 
    "inLanguage": [
      "en"
    ], 
    "isAccessibleForFree": true, 
    "isFundedItemOf": [
      {
        "id": "sg:grant.7195016", 
        "type": "MonetaryGrant"
      }
    ], 
    "isPartOf": [
      {
        "id": "sg:journal.1045337", 
        "issn": [
          "2045-2322"
        ], 
        "name": "Scientific Reports", 
        "type": "Periodical"
      }, 
      {
        "issueNumber": "1", 
        "type": "PublicationIssue"
      }, 
      {
        "type": "PublicationVolume", 
        "volumeNumber": "9"
      }
    ], 
    "name": "Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation", 
    "pagination": "3966", 
    "productId": [
      {
        "name": "readcube_id", 
        "type": "PropertyValue", 
        "value": [
          "b793dd2ffbdf0d746036bd67c010d79784310600a0261d14f501923495bee13a"
        ]
      }, 
      {
        "name": "pubmed_id", 
        "type": "PropertyValue", 
        "value": [
          "30850693"
        ]
      }, 
      {
        "name": "nlm_unique_id", 
        "type": "PropertyValue", 
        "value": [
          "101563288"
        ]
      }, 
      {
        "name": "doi", 
        "type": "PropertyValue", 
        "value": [
          "10.1038/s41598-019-39941-5"
        ]
      }, 
      {
        "name": "dimensions_id", 
        "type": "PropertyValue", 
        "value": [
          "pub.1112641494"
        ]
      }
    ], 
    "sameAs": [
      "https://doi.org/10.1038/s41598-019-39941-5", 
      "https://app.dimensions.ai/details/publication/pub.1112641494"
    ], 
    "sdDataset": "articles", 
    "sdDatePublished": "2019-04-11T13:18", 
    "sdLicense": "https://scigraph.springernature.com/explorer/license/", 
    "sdPublisher": {
      "name": "Springer Nature - SN SciGraph project", 
      "type": "Organization"
    }, 
    "sdSource": "s3://com-uberresearch-data-dimensions-target-20181106-alternative/cleanup/v134/2549eaecd7973599484d7c17b260dba0a4ecb94b/merge/v9/a6c9fde33151104705d4d7ff012ea9563521a3ce/jats-lookup/v90/0000000368_0000000368/records_78947_00000001.jsonl", 
    "type": "ScholarlyArticle", 
    "url": "https://www.nature.com/articles/s41598-019-39941-5"
  }
]
 

Download the RDF metadata as:  json-ld nt turtle xml License info

HOW TO GET THIS DATA PROGRAMMATICALLY:

JSON-LD is a popular format for linked data which is fully compatible with JSON.

curl -H 'Accept: application/ld+json' 'https://scigraph.springernature.com/pub.10.1038/s41598-019-39941-5'

N-Triples is a line-based linked data format ideal for batch operations.

curl -H 'Accept: application/n-triples' 'https://scigraph.springernature.com/pub.10.1038/s41598-019-39941-5'

Turtle is a human-readable linked data format.

curl -H 'Accept: text/turtle' 'https://scigraph.springernature.com/pub.10.1038/s41598-019-39941-5'

RDF/XML is a standard XML format for linked data.

curl -H 'Accept: application/rdf+xml' 'https://scigraph.springernature.com/pub.10.1038/s41598-019-39941-5'


 

This table displays all metadata directly associated to this object as RDF triples.

323 TRIPLES      21 PREDICATES      98 URIs      21 LITERALS      9 BLANK NODES

Subject Predicate Object
1 sg:pub.10.1038/s41598-019-39941-5 schema:about anzsrc-for:06
2 anzsrc-for:0601
3 schema:author Ne0012b5eff49488585ea3f9d37bb9e93
4 schema:citation sg:pub.10.1007/bf01961241
5 sg:pub.10.1007/s00216-012-6322-y
6 sg:pub.10.1007/s11426-014-5235-3
7 sg:pub.10.1023/a:1020277223482
8 sg:pub.10.1038/35052073
9 sg:pub.10.1038/ncb0901-785
10 sg:pub.10.1038/nprot.2007.406
11 sg:pub.10.1038/nrc749
12 sg:pub.10.1038/nrd793
13 sg:pub.10.1038/sj.onc.1204041
14 sg:pub.10.1038/sj.onc.1210478
15 https://app.dimensions.ai/details/publication/pub.1075287996
16 https://doi.org/10.1002/anie.201709184
17 https://doi.org/10.1002/jcc.20084
18 https://doi.org/10.1002/mas.20315
19 https://doi.org/10.1006/jmbi.2001.5047
20 https://doi.org/10.1016/0022-2836(92)90497-8
21 https://doi.org/10.1016/j.biochi.2008.02.019
22 https://doi.org/10.1016/j.biochi.2008.02.026
23 https://doi.org/10.1016/j.biochi.2018.06.024
24 https://doi.org/10.1016/j.bmcl.2018.06.021
25 https://doi.org/10.1016/j.cbpa.2009.04.637
26 https://doi.org/10.1016/j.ymeth.2012.03.011
27 https://doi.org/10.1016/j.ymeth.2012.05.003
28 https://doi.org/10.1016/s0165-6147(00)01457-7
29 https://doi.org/10.1021/ac900785m
30 https://doi.org/10.1021/bi0355185
31 https://doi.org/10.1021/bi051618u
32 https://doi.org/10.1021/bi4015727
33 https://doi.org/10.1021/ja011977m
34 https://doi.org/10.1021/ja065989p
35 https://doi.org/10.1021/ja205646q
36 https://doi.org/10.1021/ja208483v
37 https://doi.org/10.1021/ja310251r
38 https://doi.org/10.1021/ja312403b
39 https://doi.org/10.1021/ja4118945
40 https://doi.org/10.1021/ja412128w
41 https://doi.org/10.1021/ja4125274
42 https://doi.org/10.1021/jacs.6b12274
43 https://doi.org/10.1021/ol302918f
44 https://doi.org/10.1039/c003428b
45 https://doi.org/10.1039/c0cs00134a
46 https://doi.org/10.1039/c1ob05891f
47 https://doi.org/10.1073/pnas.182256799
48 https://doi.org/10.1073/pnas.88.1.26
49 https://doi.org/10.1074/jbc.m303694200
50 https://doi.org/10.1089/oli.2005.15.36
51 https://doi.org/10.1093/nar/20.15.4061
52 https://doi.org/10.1093/nar/gki553
53 https://doi.org/10.1093/nar/gki609
54 https://doi.org/10.1093/nar/gkl529
55 https://doi.org/10.1093/nar/gkl610
56 https://doi.org/10.1093/nar/gkl655
57 https://doi.org/10.1093/nar/gkm1069
58 https://doi.org/10.1093/nar/gkm711
59 https://doi.org/10.1093/nar/gkp026
60 https://doi.org/10.1093/nar/gkr233
61 https://doi.org/10.1093/nar/gkt784
62 https://doi.org/10.1097/pap.0000000000000015
63 https://doi.org/10.1107/s0907444998003254
64 https://doi.org/10.1111/j.1742-4658.2009.07464.x
65 https://doi.org/10.1126/science.2470152
66 https://doi.org/10.1126/science.7892601
67 https://doi.org/10.1158/1078-0432.ccr-11-1795
68 https://doi.org/10.1172/jci116850
69 https://doi.org/10.1371/journal.pgen.1003468
70 https://doi.org/10.3390/molecules171113073
71 https://doi.org/10.3998/ark.5550190.p008.384
72 https://doi.org/10.4155/fmc.09.172
73 schema:datePublished 2019-12
74 schema:datePublishedReg 2019-12-01
75 schema:description G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.
76 schema:genre research_article
77 schema:inLanguage en
78 schema:isAccessibleForFree true
79 schema:isPartOf N12a5911a53404df2876281229329d642
80 N600572d5deca413a8b0d546df561a7e7
81 sg:journal.1045337
82 schema:name Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation
83 schema:pagination 3966
84 schema:productId N33ba7c849ed74979bdaf715cb45bb375
85 N4b305eeb3d3e43939679bcb81bc508af
86 N4df7c9d491a14162a9cfd39c30c1d719
87 Na997e25865e347468fe96c0ba241a2f9
88 Naf0e8c8717654c03b2df70e0c70d21b7
89 schema:sameAs https://app.dimensions.ai/details/publication/pub.1112641494
90 https://doi.org/10.1038/s41598-019-39941-5
91 schema:sdDatePublished 2019-04-11T13:18
92 schema:sdLicense https://scigraph.springernature.com/explorer/license/
93 schema:sdPublisher Nfa7a24e1d3eb4455b37804bd82cbebd7
94 schema:url https://www.nature.com/articles/s41598-019-39941-5
95 sgo:license sg:explorer/license/
96 sgo:sdDataset articles
97 rdf:type schema:ScholarlyArticle
98 N0d7fcaa68172407c993118c09d0e7100 schema:affiliation https://www.grid.ac/institutes/grid.11135.37
99 schema:familyName Zhang
100 schema:givenName Qiang
101 rdf:type schema:Person
102 N12a5911a53404df2876281229329d642 schema:issueNumber 1
103 rdf:type schema:PublicationIssue
104 N33ba7c849ed74979bdaf715cb45bb375 schema:name pubmed_id
105 schema:value 30850693
106 rdf:type schema:PropertyValue
107 N3a44ae99b8a74660bb07723eeeb2708c rdf:first Ne5eefa5b66d240509a9daa4b3c6cc3b2
108 rdf:rest N6d7f90b20bdf47a9a474abbecb240ee3
109 N4b305eeb3d3e43939679bcb81bc508af schema:name doi
110 schema:value 10.1038/s41598-019-39941-5
111 rdf:type schema:PropertyValue
112 N4df7c9d491a14162a9cfd39c30c1d719 schema:name readcube_id
113 schema:value b793dd2ffbdf0d746036bd67c010d79784310600a0261d14f501923495bee13a
114 rdf:type schema:PropertyValue
115 N54b2bbba413645a38c5b5d7425d35c65 schema:affiliation https://www.grid.ac/institutes/grid.11135.37
116 schema:familyName Zhou
117 schema:givenName Jiang
118 rdf:type schema:Person
119 N600572d5deca413a8b0d546df561a7e7 schema:volumeNumber 9
120 rdf:type schema:PublicationVolume
121 N6a65ecab27d04218b9f3f9f9cfc7eb4a rdf:first Nda7654988ee141f8af46736144240043
122 rdf:rest Nedb3304c59084ca8a820ae9d4265c6e3
123 N6d7f90b20bdf47a9a474abbecb240ee3 rdf:first N0d7fcaa68172407c993118c09d0e7100
124 rdf:rest Ndeb8ba896ba749fa96ddb1db9eca866d
125 Na997e25865e347468fe96c0ba241a2f9 schema:name nlm_unique_id
126 schema:value 101563288
127 rdf:type schema:PropertyValue
128 Naf0e8c8717654c03b2df70e0c70d21b7 schema:name dimensions_id
129 schema:value pub.1112641494
130 rdf:type schema:PropertyValue
131 Nb3be4dbd4ad74f58b98e5055f6289737 schema:affiliation https://www.grid.ac/institutes/grid.411642.4
132 schema:familyName Xu
133 schema:givenName Ming
134 rdf:type schema:Person
135 Ncc83a81b4ab1495eafc66e48e334a547 schema:affiliation https://www.grid.ac/institutes/grid.411077.4
136 schema:familyName Cui
137 schema:givenName Xiaojie
138 rdf:type schema:Person
139 Nda7654988ee141f8af46736144240043 schema:affiliation https://www.grid.ac/institutes/grid.11135.37
140 schema:familyName Yuan
141 schema:givenName Gu
142 rdf:type schema:Person
143 Ndeb8ba896ba749fa96ddb1db9eca866d rdf:first Nb3be4dbd4ad74f58b98e5055f6289737
144 rdf:rest N6a65ecab27d04218b9f3f9f9cfc7eb4a
145 Ne0012b5eff49488585ea3f9d37bb9e93 rdf:first Ncc83a81b4ab1495eafc66e48e334a547
146 rdf:rest N3a44ae99b8a74660bb07723eeeb2708c
147 Ne5eefa5b66d240509a9daa4b3c6cc3b2 schema:affiliation https://www.grid.ac/institutes/grid.11135.37
148 schema:familyName Chen
149 schema:givenName Han
150 rdf:type schema:Person
151 Nedb3304c59084ca8a820ae9d4265c6e3 rdf:first N54b2bbba413645a38c5b5d7425d35c65
152 rdf:rest rdf:nil
153 Nfa7a24e1d3eb4455b37804bd82cbebd7 schema:name Springer Nature - SN SciGraph project
154 rdf:type schema:Organization
155 anzsrc-for:06 schema:inDefinedTermSet anzsrc-for:
156 schema:name Biological Sciences
157 rdf:type schema:DefinedTerm
158 anzsrc-for:0601 schema:inDefinedTermSet anzsrc-for:
159 schema:name Biochemistry and Cell Biology
160 rdf:type schema:DefinedTerm
161 sg:grant.7195016 http://pending.schema.org/fundedItem sg:pub.10.1038/s41598-019-39941-5
162 rdf:type schema:MonetaryGrant
163 sg:journal.1045337 schema:issn 2045-2322
164 schema:name Scientific Reports
165 rdf:type schema:Periodical
166 sg:pub.10.1007/bf01961241 schema:sameAs https://app.dimensions.ai/details/publication/pub.1002229729
167 https://doi.org/10.1007/bf01961241
168 rdf:type schema:CreativeWork
169 sg:pub.10.1007/s00216-012-6322-y schema:sameAs https://app.dimensions.ai/details/publication/pub.1021642836
170 https://doi.org/10.1007/s00216-012-6322-y
171 rdf:type schema:CreativeWork
172 sg:pub.10.1007/s11426-014-5235-3 schema:sameAs https://app.dimensions.ai/details/publication/pub.1007868472
173 https://doi.org/10.1007/s11426-014-5235-3
174 rdf:type schema:CreativeWork
175 sg:pub.10.1023/a:1020277223482 schema:sameAs https://app.dimensions.ai/details/publication/pub.1019179185
176 https://doi.org/10.1023/a:1020277223482
177 rdf:type schema:CreativeWork
178 sg:pub.10.1038/35052073 schema:sameAs https://app.dimensions.ai/details/publication/pub.1053565592
179 https://doi.org/10.1038/35052073
180 rdf:type schema:CreativeWork
181 sg:pub.10.1038/ncb0901-785 schema:sameAs https://app.dimensions.ai/details/publication/pub.1049996477
182 https://doi.org/10.1038/ncb0901-785
183 rdf:type schema:CreativeWork
184 sg:pub.10.1038/nprot.2007.406 schema:sameAs https://app.dimensions.ai/details/publication/pub.1035232696
185 https://doi.org/10.1038/nprot.2007.406
186 rdf:type schema:CreativeWork
187 sg:pub.10.1038/nrc749 schema:sameAs https://app.dimensions.ai/details/publication/pub.1021025403
188 https://doi.org/10.1038/nrc749
189 rdf:type schema:CreativeWork
190 sg:pub.10.1038/nrd793 schema:sameAs https://app.dimensions.ai/details/publication/pub.1007921828
191 https://doi.org/10.1038/nrd793
192 rdf:type schema:CreativeWork
193 sg:pub.10.1038/sj.onc.1204041 schema:sameAs https://app.dimensions.ai/details/publication/pub.1029565491
194 https://doi.org/10.1038/sj.onc.1204041
195 rdf:type schema:CreativeWork
196 sg:pub.10.1038/sj.onc.1210478 schema:sameAs https://app.dimensions.ai/details/publication/pub.1051505323
197 https://doi.org/10.1038/sj.onc.1210478
198 rdf:type schema:CreativeWork
199 https://app.dimensions.ai/details/publication/pub.1075287996 schema:CreativeWork
200 https://doi.org/10.1002/anie.201709184 schema:sameAs https://app.dimensions.ai/details/publication/pub.1092401801
201 rdf:type schema:CreativeWork
202 https://doi.org/10.1002/jcc.20084 schema:sameAs https://app.dimensions.ai/details/publication/pub.1008225564
203 rdf:type schema:CreativeWork
204 https://doi.org/10.1002/mas.20315 schema:sameAs https://app.dimensions.ai/details/publication/pub.1035933673
205 rdf:type schema:CreativeWork
206 https://doi.org/10.1006/jmbi.2001.5047 schema:sameAs https://app.dimensions.ai/details/publication/pub.1007472005
207 rdf:type schema:CreativeWork
208 https://doi.org/10.1016/0022-2836(92)90497-8 schema:sameAs https://app.dimensions.ai/details/publication/pub.1022845043
209 rdf:type schema:CreativeWork
210 https://doi.org/10.1016/j.biochi.2008.02.019 schema:sameAs https://app.dimensions.ai/details/publication/pub.1032023729
211 rdf:type schema:CreativeWork
212 https://doi.org/10.1016/j.biochi.2008.02.026 schema:sameAs https://app.dimensions.ai/details/publication/pub.1024103020
213 rdf:type schema:CreativeWork
214 https://doi.org/10.1016/j.biochi.2018.06.024 schema:sameAs https://app.dimensions.ai/details/publication/pub.1105213939
215 rdf:type schema:CreativeWork
216 https://doi.org/10.1016/j.bmcl.2018.06.021 schema:sameAs https://app.dimensions.ai/details/publication/pub.1104562078
217 rdf:type schema:CreativeWork
218 https://doi.org/10.1016/j.cbpa.2009.04.637 schema:sameAs https://app.dimensions.ai/details/publication/pub.1051506681
219 rdf:type schema:CreativeWork
220 https://doi.org/10.1016/j.ymeth.2012.03.011 schema:sameAs https://app.dimensions.ai/details/publication/pub.1030526180
221 rdf:type schema:CreativeWork
222 https://doi.org/10.1016/j.ymeth.2012.05.003 schema:sameAs https://app.dimensions.ai/details/publication/pub.1014529698
223 rdf:type schema:CreativeWork
224 https://doi.org/10.1016/s0165-6147(00)01457-7 schema:sameAs https://app.dimensions.ai/details/publication/pub.1029818167
225 rdf:type schema:CreativeWork
226 https://doi.org/10.1021/ac900785m schema:sameAs https://app.dimensions.ai/details/publication/pub.1055071281
227 rdf:type schema:CreativeWork
228 https://doi.org/10.1021/bi0355185 schema:sameAs https://app.dimensions.ai/details/publication/pub.1055197862
229 rdf:type schema:CreativeWork
230 https://doi.org/10.1021/bi051618u schema:sameAs https://app.dimensions.ai/details/publication/pub.1055201030
231 rdf:type schema:CreativeWork
232 https://doi.org/10.1021/bi4015727 schema:sameAs https://app.dimensions.ai/details/publication/pub.1055206371
233 rdf:type schema:CreativeWork
234 https://doi.org/10.1021/ja011977m schema:sameAs https://app.dimensions.ai/details/publication/pub.1015941088
235 rdf:type schema:CreativeWork
236 https://doi.org/10.1021/ja065989p schema:sameAs https://app.dimensions.ai/details/publication/pub.1035955792
237 rdf:type schema:CreativeWork
238 https://doi.org/10.1021/ja205646q schema:sameAs https://app.dimensions.ai/details/publication/pub.1055850500
239 rdf:type schema:CreativeWork
240 https://doi.org/10.1021/ja208483v schema:sameAs https://app.dimensions.ai/details/publication/pub.1055851089
241 rdf:type schema:CreativeWork
242 https://doi.org/10.1021/ja310251r schema:sameAs https://app.dimensions.ai/details/publication/pub.1052165928
243 rdf:type schema:CreativeWork
244 https://doi.org/10.1021/ja312403b schema:sameAs https://app.dimensions.ai/details/publication/pub.1041077983
245 rdf:type schema:CreativeWork
246 https://doi.org/10.1021/ja4118945 schema:sameAs https://app.dimensions.ai/details/publication/pub.1041180905
247 rdf:type schema:CreativeWork
248 https://doi.org/10.1021/ja412128w schema:sameAs https://app.dimensions.ai/details/publication/pub.1043381320
249 rdf:type schema:CreativeWork
250 https://doi.org/10.1021/ja4125274 schema:sameAs https://app.dimensions.ai/details/publication/pub.1006544720
251 rdf:type schema:CreativeWork
252 https://doi.org/10.1021/jacs.6b12274 schema:sameAs https://app.dimensions.ai/details/publication/pub.1083734215
253 rdf:type schema:CreativeWork
254 https://doi.org/10.1021/ol302918f schema:sameAs https://app.dimensions.ai/details/publication/pub.1056253826
255 rdf:type schema:CreativeWork
256 https://doi.org/10.1039/c003428b schema:sameAs https://app.dimensions.ai/details/publication/pub.1000437555
257 rdf:type schema:CreativeWork
258 https://doi.org/10.1039/c0cs00134a schema:sameAs https://app.dimensions.ai/details/publication/pub.1050613242
259 rdf:type schema:CreativeWork
260 https://doi.org/10.1039/c1ob05891f schema:sameAs https://app.dimensions.ai/details/publication/pub.1033405620
261 rdf:type schema:CreativeWork
262 https://doi.org/10.1073/pnas.182256799 schema:sameAs https://app.dimensions.ai/details/publication/pub.1051343212
263 rdf:type schema:CreativeWork
264 https://doi.org/10.1073/pnas.88.1.26 schema:sameAs https://app.dimensions.ai/details/publication/pub.1050446620
265 rdf:type schema:CreativeWork
266 https://doi.org/10.1074/jbc.m303694200 schema:sameAs https://app.dimensions.ai/details/publication/pub.1049681429
267 rdf:type schema:CreativeWork
268 https://doi.org/10.1089/oli.2005.15.36 schema:sameAs https://app.dimensions.ai/details/publication/pub.1059303279
269 rdf:type schema:CreativeWork
270 https://doi.org/10.1093/nar/20.15.4061 schema:sameAs https://app.dimensions.ai/details/publication/pub.1004745646
271 rdf:type schema:CreativeWork
272 https://doi.org/10.1093/nar/gki553 schema:sameAs https://app.dimensions.ai/details/publication/pub.1052041968
273 rdf:type schema:CreativeWork
274 https://doi.org/10.1093/nar/gki609 schema:sameAs https://app.dimensions.ai/details/publication/pub.1040818998
275 rdf:type schema:CreativeWork
276 https://doi.org/10.1093/nar/gkl529 schema:sameAs https://app.dimensions.ai/details/publication/pub.1013971176
277 rdf:type schema:CreativeWork
278 https://doi.org/10.1093/nar/gkl610 schema:sameAs https://app.dimensions.ai/details/publication/pub.1050161161
279 rdf:type schema:CreativeWork
280 https://doi.org/10.1093/nar/gkl655 schema:sameAs https://app.dimensions.ai/details/publication/pub.1046370465
281 rdf:type schema:CreativeWork
282 https://doi.org/10.1093/nar/gkm1069 schema:sameAs https://app.dimensions.ai/details/publication/pub.1009212183
283 rdf:type schema:CreativeWork
284 https://doi.org/10.1093/nar/gkm711 schema:sameAs https://app.dimensions.ai/details/publication/pub.1017092385
285 rdf:type schema:CreativeWork
286 https://doi.org/10.1093/nar/gkp026 schema:sameAs https://app.dimensions.ai/details/publication/pub.1006892534
287 rdf:type schema:CreativeWork
288 https://doi.org/10.1093/nar/gkr233 schema:sameAs https://app.dimensions.ai/details/publication/pub.1026737043
289 rdf:type schema:CreativeWork
290 https://doi.org/10.1093/nar/gkt784 schema:sameAs https://app.dimensions.ai/details/publication/pub.1039889426
291 rdf:type schema:CreativeWork
292 https://doi.org/10.1097/pap.0000000000000015 schema:sameAs https://app.dimensions.ai/details/publication/pub.1028998822
293 rdf:type schema:CreativeWork
294 https://doi.org/10.1107/s0907444998003254 schema:sameAs https://app.dimensions.ai/details/publication/pub.1019779527
295 rdf:type schema:CreativeWork
296 https://doi.org/10.1111/j.1742-4658.2009.07464.x schema:sameAs https://app.dimensions.ai/details/publication/pub.1001394805
297 rdf:type schema:CreativeWork
298 https://doi.org/10.1126/science.2470152 schema:sameAs https://app.dimensions.ai/details/publication/pub.1062539373
299 rdf:type schema:CreativeWork
300 https://doi.org/10.1126/science.7892601 schema:sameAs https://app.dimensions.ai/details/publication/pub.1062650037
301 rdf:type schema:CreativeWork
302 https://doi.org/10.1158/1078-0432.ccr-11-1795 schema:sameAs https://app.dimensions.ai/details/publication/pub.1027513651
303 rdf:type schema:CreativeWork
304 https://doi.org/10.1172/jci116850 schema:sameAs https://app.dimensions.ai/details/publication/pub.1023361792
305 rdf:type schema:CreativeWork
306 https://doi.org/10.1371/journal.pgen.1003468 schema:sameAs https://app.dimensions.ai/details/publication/pub.1050265935
307 rdf:type schema:CreativeWork
308 https://doi.org/10.3390/molecules171113073 schema:sameAs https://app.dimensions.ai/details/publication/pub.1040547844
309 rdf:type schema:CreativeWork
310 https://doi.org/10.3998/ark.5550190.p008.384 schema:sameAs https://app.dimensions.ai/details/publication/pub.1071818299
311 rdf:type schema:CreativeWork
312 https://doi.org/10.4155/fmc.09.172 schema:sameAs https://app.dimensions.ai/details/publication/pub.1009323209
313 rdf:type schema:CreativeWork
314 https://www.grid.ac/institutes/grid.11135.37 schema:alternateName Peking University
315 schema:name Beijing National Laboratory for Molecular Sciences, Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, 100871, Beijing, China
316 rdf:type schema:Organization
317 https://www.grid.ac/institutes/grid.411077.4 schema:alternateName Minzu University of China
318 schema:name Beijing National Laboratory for Molecular Sciences, Key Laboratory of Bioorganic Chemistry and Molecular Engineering of Ministry of Education, Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, 100871, Beijing, China
319 College of Life and Environmental Sciences, Minzu University of China, 100081, Beijing, China
320 rdf:type schema:Organization
321 https://www.grid.ac/institutes/grid.411642.4 schema:alternateName Peking University Third Hospital
322 schema:name Department of Cardiology, Institute of Vascular Medicine, Department of Cardiology, Peking University Third Hospital, 100191, Beijing, China
323 rdf:type schema:Organization
 




Preview window. Press ESC to close (or click here)


...